MHC Class II - PDFSEARCH.IO - Document Search Engine

MHC Class II
Results: 153

#	Item
61	Additional file 5. Nucleotide sequences of MHC class II DRB genes in the Scandinavian brown bear. >Urar-DRB11 GTGCGGTACCTGGTCAGAGACATCTATAACGGGCAGGAGAACGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGACGGAGCTGGGGCGGCCCATCGCTGA Add to Reading List Source URL: www.biomedcentral.com Language: English*
62	W138–W142 Nucleic Acids Research, 2005, Vol. 33, Web Server issue doi:[removed]nar/gki357 PEPVAC: a web server for multi-epitope vaccine development based on the prediction of supertypic MHC ligands Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English Glycoproteins Immunology Major histocompatibility complex HLA-A Human leukocyte antigen MHC class II MHC class I Epitope Immunogenicity Immune system Biology Genes
63	Test Request Form 640 Ellicott Street, Buffalo, NY[removed]Phone[removed] • Fax[removed]IMMUNOGENETICS LABORATORY HSC/BM Services Add to Reading List Source URL: immco.com Language: English - Date: 2012-04-14 16:11:51 HLA-A Human leukocyte antigen HLA-DR HLA-DR12 HLA-DR11 Biology MHC Class II Immune system
64	Human Major Histocompatibility Complex (MHC) Add to Reading List Source URL: www.seattlecca.org Language: English - Date: 2008-07-17 11:37:35 Genes MHC Class II Human leukocyte antigen Immunology HLA-A HLA-DR Major histocompatibility complex Chromosome 6 Major histocompatibility complex class II DQ alpha 1 Biology Genetics Immune system
65	EQA Schedule of Accreditation issued by Clinical Pathology Accreditation (UK) Ltd[removed]High Street, Feltham, Middlesex, TW13 4UN EQA Reference No: 036 Add to Reading List Source URL: www.ukas.com Language: English - Date: 2014-11-03 10:25:08 Human leukocyte antigen Immune system Immunology HLA-B HLA-DR HLA-A Genetics Biology MHC Class II
66	Schedule of Accreditation issued by United Kingdom Accreditation Service[removed]High Street, Feltham, Middlesex, TW13 4UN, UK Add to Reading List Source URL: www.ukas.org Language: English - Date: 2014-10-01 06:44:56 MHC Class II Human leukocyte antigen Immunology HLA-DRB1 HLA-DR Assay HLA-A Chemistry Biology Immune system
67	Microsoft Word - toxins[removed]manuscript.docx Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English Superantigen Exotoxin Major histocompatibility complex Enterotoxin Toxic shock syndrome Staphylococcal Enterotoxin B Human leukocyte antigen T cell MHC class II Biology Immune system Staphylococcus aureus
68	Microsoft Word - Blood Services Update December Holiday Schedule 2014 Add to Reading List Source URL: www.indianablood.org Language: English - Date: 2014-12-30 17:29:18 Blood banks MHC Class II
69	Late Abstracts Contents SESSION SUN CSI-01 Cell cycle & checkpoints............................................................................................................... 4 Add to Reading List Source URL: www.febs-embo2014.org Language: English - Date: 2014-08-30 14:37:01 Genes Glycoproteins Molecular biology DnaA Major histocompatibility complex DnaB helicase Progeria Expression vector MHC class II Biology DNA replication Immune system
70	THE CR AFOORD PRIZE IN POLYARTHRITIS 2013 INFORMATION FOR THE PUBLIC Detective work reveals new secrets about rheumatoid arthritis For a long time, some aspects of the genetics of rheumatoid arthritis perplexed scientist Add to Reading List Source URL: www.kva.se Language: English - Date: 2014-07-02 23:37:45 Arthritis Rheumatology Autoimmune diseases Connective tissue diseases MHC Class II Peter K. Gregersen Rheumatoid arthritis HLA-DR Human leukocyte antigen Health Medicine Biology

UPDATE